The RT product (2 microl) was used to perform PCR of IE-1 exon-4 and US28 transcripts with following pairs of primers: IE-1 forward primer – 5�� CTCTGTCCTCAGTAATTGTGGCTG 3�� IE-1 Reverse primer: 5�� GCAACTTCCTCTATCTCAGACACTG3��. sellekchem US 28 forward primer: 5�� AGCGTGCCGTGTACGTTAC-3�� US28 reverse primer: 5�� – ATAAAGACAAGCACGACC – 3��. The beta-globin gene was amplified as an internal control (sense, 5��-TCCCCTCCTACCCCTACTTTCTA-3��; antisens, 5��-TGCCTGGACTAATCTGCAAGAG-3��). The PCR product was analysed on a 2% agarose gel and visualized after staining with ethidium bromide. For quantitative RT-PCR, 2 microl cDNA product was used in 50 microl cDNA amplification reaction with 300 nM of IE-1 and US-28 primers (mentioned earlier) along with syber green PCR master mix (Qiagen, Hilden, Germany).
The reaction were set up in MicroAmp optical 96-well reaction plate (Applied Biosystems), sealed and cycled on Stratagene MX3005P realtime qPCR system (Stratagene) with 95��C for 10 min, followed by 40 cycles at 95��C for 15 sec and annealing/extension on 60��C for 1 min. The DeltaCt values were calculated by subtracting the Ct values of HCMV infected cells from Ct values of uninfected or UV inactivated HCMV infected cells. Viral entry assay Viral entry into HepG2 cells, PHH and MRC5 fibroblasts was assayed as described previously [21]. Cells were incubated at 37��C with HCMV-AD169 at MOIs of 1 and 10 for 2 h and washed three times with PBS. Cells were treated with 0.25% trypsin for 10 min to release the virions that had adhered to the surface but had not entered the cell.
The cells were pelleted and washed once with serum neutralization solution and three times with PBS. DNA was extracted from the cell pellet using the KingFisher automatic instrument (Thermo Labsystems) and a QIAamp kit (Qiagen) according to the recommendations of the manufacturers. Samples of eluted DNA were analyzed by PCR using primers specific for the MIEP of HCMV (sense, 5��-TGGGACTTTCCTACTTGG-3��; antisense, 5��-CCAGGCGATCTGACGGTT-3��). The beta-globin PCR gene was used as an internal control (sense, 5��-TCCCCTCCTACCCCTACTTTCTA-3��; antisens, 5��-TGCCTGGACTAATCTGCAAGAG-3��). The amplification products were resolved by 2% agarose gel electrophoresis and visualized by ethidium bromide staining.
Western blotting Cellular extracts of HepG2 cells or PHH, either uninfected or infected with HCMV, were used to examine STAT3, Batimastat pSTAT3, cyclin D1, survivin, JAK, p53, p21waf, Mdm2, HCMV pp72 IE antigen, HCMV US28 antigen, HCMV pp65 antigen, HCMV 65 kD structural late antigen and beta-actin protein expression by Western blotting as described previously [21]. Cell proliferation For proliferation assays, HepG2 cells and PHH were left uninfected or were infected with HCMV. Proliferation was measured using the MTT cell proliferation assay kit (Cayman Chemical, Ann Arbor, MI).