This probe set was then extended by searching public databases fo

This probe set was then extended by searching public databases for additional probes for the ITS regions and the EF-1 α gene. No unique probes could be designed for Drechslera species, Eurotium chevalieri,

Fusarium sambucinum, F. semitectum, Penicillium funiculosum, P. rugulosum and Pithomyces chartarum. The Fusarium and Penicillium strains share many sequence similarities with the other species used in this study. This rendered the development of species-specific oligonucleotide probes more difficult. For the strains Pithomyces and Eurotium no unique polymorphisms could be identified that could be used for the design check details of unique probes. Table 1 Probe sequences and names of species- and toxin- specific genes for different fungal isolates Probe Probe sequence (5′ → 3′)a Probe specificityb PCR annealing temperature (°C) for amplification Reference (NCBI accession number) Internal Transcribed regions AaF AaR GACCGCT TT CGTGGTATGCA Alternaria alternata 56 This study [GenBank:FJ864712] AR1 ATCTGCTGCACAGTTGGCT Aspergillus carbonarius 56 This study [GenBank:FJ864707] AcarF AcarR TGGCACCATTCGTCCTAC CCCGAGGCAGAGATG Aspergillus carbonarius 55 This study [Genbank:FJ864707]

AClF ATTCGGAAACCUGCTCAGTACG Aspergillus clavatus 58 This study [Genbank:EU515153, EF669942] AclaF AclaR GCCGCCGTCTTCGGA CGTGTTGTACAACGTTTA Aspergillus clavatus 57 This study [Genbank:EU078633] ApaF ApaR see more GTGTACGAGTTCCTAGCG GCCCGGGCTGACG Aspergillus parasiticus 55 This study [GenBank:FJ864709] Vorinostat cell line AVER CCAACGCAGTTACTTCA Aspergillus versicolor 56 This study [GenBank:FJ864703] ANIG PRKACG ACGTTATCCAACCAT Aspergillus niger 55 This

study [GenBank:FJ864708] AnigF AnigR ATTCGCCGGAGACCCCAACA TGTTGAAAGTTTTAACTGATTGCATT Aspergillus niger 55 This study [GenBank:FJ864708] EurAF EurAR TGGCGGCACCATGTC TGGTTAAAAGATTGGTTGCGA Eurotium amstelodami 58 This study [GenBank:FJ864711] SL24F SL24R CGGAAGGATCATTACTGAGTG GCCCGCCGAAGCAAC Penicillium spp., Aspergillus spp. 58 This study [Genbank:AM270353, AM270995, DQ469292, DQ249211] IT59 ITS60 CGTGTTTATTTACCT ACAGAGCGGTGACA Penicillium spp. 58 This study [EU7975707.1] PenCorF PenCorR GTCCAAACCCTCCCACCCA GTCAGACTTGCAATCTTCAGACTGT Penicillium corylophilum 55 This study [FJ864704] PenExF PenExR TTACCGAGTGAGGCCGT GCCAGCCTGACAGCTACG Penicllium expansum 58 This study [Genbank:FJ861424] PenFeF PenFeR CTGAGTGCGGGCCCTCT CGCCGAAGCAACACTGTAAG Penicillium fellutanum 55 This study [Genbank:EF200082] PenIsF PenIsR CGAGTGCGGGTTCGACA GGCAACGCGGTAACGGTAG Penicilliun islandicum 57 This study [Genbank:AF455543] PenItF PenItR CTCCCACCCGTGTTTATTTATCA TCACTCAGACGACAATCTTCAGG Penicillium italicum 57 This study [Genbank:DQ991463] ITSF ITSR CAACTCCAAACCCCTGTGA GCGACGATTACCAGTAACGA Fusarium spp.

Leave a Reply

Your email address will not be published. Required fields are marked *

*

You may use these HTML tags and attributes: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong>