innocua strains, 5 from reference collections, 13 from meat, 8 from milk and 8 from seafoods, and 4 L. welshimeri strains. Listeria strains were retrieved from glycerol stocks maintained at -80°C, and cultured in brain heart infusion broth (BHI; Oxoid, Hampshire, England) at 37°C. learn more Carbohydrate fermentation and hemolytic reactions The recommended www.selleckchem.com/products/hsp990-nvp-hsp990.html biochemical patterns for differentiating Listeria spp. included L-rhamnose, D-xylose, D-mannitol and glucose utilization and hemolytic reactivity, and were tested by using
conventional procedures [36, 37]. DNA manipulations Genomic DNA was extracted using a protocol reported previously [12]. Oligonucleotide primers were synthesized by Invitrogen Biotechnology (Shanghai, China) (Table 6 and Additional file 1; table S2), and Taq DNA polymerase (TaKaRa Biotech Co. Ltd., Dalian, China) was used for PCR amplification. PCR was conducted using a PT-200 thermal cycler (MJ Research Inc. MA, Boston, USA), with annealing temperatures depending on specific primer pairs (Table 6 and Additional file 1; table S2), and the duration of extension depending on the expected length of
amplicon (1 min per kb, at 72°C). For DNA sequencing analysis, PCR fragments were purified with the AxyPrep DNA Gel Extraction Kit (Axygen Inc., USA) and their sequences determined by dideoxy method on ABI-PRISM 377 DNA sequencer. Table 6 Primers used for MLST Locus Putative function Locationa Forward primer NU7026 solubility dmso Tenoxicam Reverse primer Length (bp) gyrB DNA gyrase subunit B 6,031-7,971 TGGTGCATCGGTAGTTAATGC CAACATCTGGGTTTTCCATCAT 657 dapE Succinyl diaminopimelate desuccinylase 301,402-302,538 GTAAATATTGATTCGACTAATG CACTAGCACTTGTTTCACTG 669 hisJ Histidinol phosphate phosphatase 606,408-607,235 TCCACATGGTACGCATGAT GGACATGTCAAAATGAAAGATC
714 sigB Stess responsive alternative sigma factor B 924,734-925,513 CCAAAAGTATCTCAACCTGAT CATGCATTTGTGATATATCGA 642 ribC Riboflavin kinaseand FAD synthase 1,364,536-1,365,480 AAGACGATATACTTACATCAT GTCTTTTTCTAACTGAGCA 633 purM Phosphoribosyl aminoimidazole synthase 1,893,107-1,894,153 CAAGCTCCACTTTGACAGCTAA TAAAGCAGGCGTGGACGTA 693 betL Glycine betaine transporter 2,216,882-2,218,405 ACAGAACATTATCCAAATGAGTT ACGTTGTGATTTTTTCGGTC 534 gap Glyceraldehyde 3-phosphate dehydrogenase 2,578,558-2,579,584 CTGGATCAGAAGCTGCTTCCA GTCGTATTCAAAATGTGGAAGGA 621 tuf Translation elongation factor 2,816,958-2,818,145 CATTTCTACTCCAGTTACTACT GCTCTAAACCCCATGTTA 681 Subtotal 5,844 a, Positions correspond to complete genome sequence of L. innocua strain CLIP11262 (AL592022). Internalin profiling By sequence comparison of L. monocytogenes strains F2365, H7858 (serovar 4b), EGDe and F6854 (serovar 1/2a) and L. innocua strain CLIP11262, we investigated the presence or absence of 14 L. monocytogenes-L. innocua-common and 4 L. innocua-specific internalin genes as well as 19 L. monocytogenes-specific internalin genes by PCR with specific primers outlined in Additional file 1; table S1.